HCU PHD CS MAY 2014

Question 1
One way of showing that one string is equal to another string is to compare and match them character by character. What happens if we allow both the strings to be of infinite length?
A
The method fails because we can only show that the two strings are not equal.
B
The method fails because we can only show that the two strings are equal.
C
The method works correctly and tells if the strings are equal or not.
D
The method works only if the strings are numeric.
Question 2

In the C Programming Language, arrays can be defined in two ways. The first is static: int a[4000] [3000];

the second is dynamic: declare as int **a;

and then allocate memory using malloc() . Which of the following is TRUE?
A
In the first case, memory is contiguous while in the second case, memory is not contiguous.
B
In the first case, elements may be accessed as a[i] [j], while in the second, they cannot be accessed so.
C
In the first case, the array elements are stored in row-major order, while in the second they are stored in column-major order.
D
None of the above.
       Programming       Arrays-and-pointers
Question 2 Explanation: 
In the first case the array is contiguoaus while in the second case array is not contiguos because in the second case the declaration is array of ponters to pointers.
Question 3
If flexibility is defined as having maximum choice in cache placement, which of the following is correctly ordered in ascending order of flexibility?
A
Direct Mapping, Set-Associative Mapping, Associative Mapping
B
Set-Associative Mapping, Direct Mapping, Associative Mapping
C
Associative Mapping, Set-Associative Mapping, Direct Mapping
D
None of the above.
       Computer-Organization       Cache
Question 3 Explanation: 
In direct mapping only choice is there.
In set associative mapping of set size k,there are k choices.
While in associative mapping the choice is any block of cache.
Hence ascending order of flexibility is ,
Direct mapping , Set associative Mapping, Associative mapping.
Question 4
Heap sort may be considered as
A
Insertion sort done on a heap data structure instead of a list.
B
Selection sort done on a heap data structure instead of a list.
C
Bubble sort done on a heap data structure instead of a list.
D
None of the above.
       Algorithms       Sorting
Question 4 Explanation: 
When we do min or max heapify in heap sort, we get the min or max element in the root then we exchange it with the last element. And we repeat the procedure for the remaining element .
We do similar type in selection sort,we find min or max element and then we exchange that element with first element and we repeat the element with the remaining procedure .
Question 5
Which of the following is NOT a feature of the Von Neumann architecture?
A
Storage space for programs.
B
Storage space for data
C
Unique next instruction for execution.
D
Separating instructions from data.
Question 6

The correct result of Lexicographically sorting

109, 20, 119, 2,207, 27, 19

in ascending order is:
A
19, 109, 119, 2, 20, 27, 207
B
109, 119, 19, 2,20,27,207
C
109, 119, 19, 2,20,207,27
D
2, 19, 20, 27, 109, 119 , 207
       Algorithms       Sorting
Question 6 Explanation: 
Lexicographical sorting of numbers is similar to the Lexicographical sorting of words in a dictionary.
So the correct answer is,
109,119,19,2,20,207,27
Question 7
All IP addresses in the range 186.220.64.0 to 186.220.71.254 are kept in a VLAN. The correct netmask so that messages are broadcast only within this VLAN is
A
186.220.255.255
B
186.220.248.0
C
186.220.248.0
D
186.220.8.0
       Computer-Networks       IP-Address
Question 7 Explanation: 
We have to select such subnet mask by which ANDing the both IP address we get the same network ID. And option D gives same network ID after ANDing .The network ID we get is 186.220.0.0
Question 8
Which sentence can be generated by: S → aS | bA, A → d | ccA
A
aadb
B
bccddd
C
aabccd
D
None of the above
       Theory-of-Computation       Languages-and-Grammars
Question 8 Explanation: 
S ⟶ aS
⟶ aaS (∵ S ⟶ aS)
⟶ aabA (∵ S ⟶ bA)
⟶ aabccA (∵ A ⟶ ccA)
⟶ aabccd (∵ A ⟶ d)
Question 9
Which sort uses features of the key to operate in Linear time relative to the number of elements in the array?
A
Quick Sort
B
Merge Sort
C
Radix Sort
D
Bubble Sort
       Algorithms       Sorting
Question 9 Explanation: 
Examples of sorting algorithms that run in linear time are counting sort, radix sort and bucket sort. Counting sort and radix sort assume that the input consists of integers in a small range.
Question 10
Convert FAFAFA in hexadecimal into octal.
A
76767676
B
76737672
C
76727672
D
76575372
       Digital-Logic-Design       Number-Systems
Question 10 Explanation: 
Hexadecimal number consists of 4 bit binary no. An octal number is comprising of 3 bit binary no.
So first we will convert the Hexadecimal number into binary no. and then by taking each 3 bit from right side we will convert it into octal no.
Question 11
Which of the following decision procedures does NOT have exponential time complexity?
A
Graph-colouring Problem
B
Travelling Salesperson Problem
C
Hamiltonian Circuit Problem
D
Linear Programming Problem
Question 12
Simplify the following boolean expression: 2xyz' + xy'z' + x'yz'?
A
xy + y'z' + x'y
B
xy + xz' + x'z'
C
(y + z')x
D
(x + y)z'
       Digital-Logic-Design       Boolean-Expression
Question 12 Explanation: 
2xyz’ + xy’z’ + x’yz’
= xyz’ + xyz’ + xy’z’ + x’yz’
= xyz’ + x’yz’ + xyz’ + xy’z’
= yz’ (x + x’) + xz’ (y + y’)
= yz’ + xz’
= z’(y + x)
Question 13
Which of the following problems is solvable?
A
Determining if a universal Turing machine and some input will halt
B
Writing a universal Turing machine
C
Determining if a universal Turing machine can be written in fewer than k instructions for some k
D
Determining if an arbitrary Turing machine is a universal Turing machine
       Theory-of-Computation       Turing-machines
Question 13 Explanation: 
Universal Turing Machine is a machine which can simulate the work of other turing machine.Also universal TM can accept any other machine's input other than itself.
Now lets check option wise,
A) It is the halting problem of turing machine which is undecidable.
B) Universal turing machine cannot recognize its own action,so undecidable.
C) By rice’s theorem it is undecidable.
D) If a TM can simulate the work of any other TM, then it will be UTM. Here definite "yes" and "no" ans possible. So, will be decidable
Question 14
How many possible bytes have exactly three bits on (i.e., bit=true)?
A
8*7
B
8*7*6
C
8*3
D
None of the above
Question 15

What is the value of F(4) using the following procedure?

function F(k: integer) : integer;

begin

if (k<3) then F:=k

else F := F(k-1)*f(k-2)+F(k-3);

end;
A
5
B
6
C
7
D
8
       Programming       Functions
Question 15 Explanation: 
Question 16
Queues serve a major role in:
A
simulation of recursion
B
simulation of arbitrary linked lists
C
expression evaluation
D
simulation of limited resource allocation
       Data-Structures       Queues-and-Stacks
Question 16 Explanation: 
Queues serve a major role in simulation of limited resource allocation .
Stack serves major role in simulation of recursion and expression evaluation.
Question 17
What is True for a complete bipartite graph K(3,3)?
A
it is a planar graph
B
it requires three colours to be minimally coloured
C
it is non-planar
D
it is isomorphic to K(2,4)
       Engineering-Mathematics       Graph-Theory
Question 17 Explanation: 
The graph K(5) and K(3,3) are two of the most important graphs within the subject of planarity in graph theory.Kuratowski’s theorem tells us that if we can find the subgraph in any graph that is homeomorphic to K(5) or K(3,3) then the graph is not planar,meaning its not possible for the edges to be redrawn such that they are none overlapping. Of course this theorem relies on the fact that K(5) and K(3,3) are themselves are not planar.
Question 18
A complete binary tree of level 5 has how many nodes?
A
15
B
63
C
25
D
71
E
None of the above
       Data-Structures       Binary-Trees
Question 18 Explanation: 
Tree with 5 levels of nodes has height 4. So the no. of nodes in a complete binary tree is of height 4 is
2^(4+1) - 1 = 2^5 - 1 = 31
Question 19

In the following Karnaugh map with don't care states, which values of X and Y would minimize the final function's expression length?

0 0 X 0

0 1 1 0

1 Y 1 0

0 0 0 0
A
X=0, Y=0
B
X=0, Y=1
C
X=1, Y=0
D
X=1, Y=1
       Digital-Logic-Design       K-Map
Question 19 Explanation: 
Question 20
The grammar G=<{S},{0,1},P,S>, where P={S→ SS, S→ 0S1, S→ 1S0, S→ empty} will generate a:
A
Context-free language
B
Context-sensitive language
C
Regular language
D
Recursively enumerable language
       Theory-of-Computation       Languages-and-Grammars
Question 20 Explanation: 
The given grammar generates the language which generates strings having
No. of 0’s = no. of 1’s
Which is context free language.
Question 21
In Question 20, the language generated is?
A
{0n1n where n ≥ 0}
B
{0n1n where n ≥ 0} U {1n0n where n ≥ 0}
C
{0m1k where m,k ≥ 0} U {1m0k where m,k ≥ 0}
D
{W where W has an equal number of 0's and 1's}
       Theory-of-Computation       Languages-and-Grammars
Question 21 Explanation: 
The language generated by the grammar in Q.20 is
{w where w has an equal no. of 0’s and 1’s}
Question 22

Answer Questions 22 - 25 using the following reading passage:

Since the Hawaiian Islands have never been connected to other land masses, the great variety of plants in Hawaii must be a result of the long-distance dispersal of seeds, a process that requires both a method of transport and an equivalence between the ecology of the source area and that of the recipient area.

There is some dispute about the method of transport involved. Some biologists argue that ocean and air currents are responsible for the transport of plant seeds to Hawaii. Yet the results of flotation experiments and the low temperatures of air currents cast doubt on these hypotheses. More probable is bird transport, either externally by accidental attachment of the seeds to feathers, or internally, by the

swallowing of fruit and subsequent excretion of the seeds. While it is likely that fewer varieties of plant seeds have reached Hawaii externally than internally more varieties are known to be adapted to external than to internal transport.

The author of the passage is mainly concerned with
A
discussing different approaches biologists have taken to testing theories about the distribution of plants in Hawaii
B
discussing different theories about the transport of plant seeds to Hawaii
C
discussing the extent to which air currents are responsible for the dispersal of plant seeds to Hawaii
D
resolving a dispute about the adaptability of plant seeds to bird transport
Question 23

Answer Questions 22 - 25 using the following reading passage:

Since the Hawaiian Islands have never been connected to other land masses, the great variety of plants in Hawaii must be a result of the long-distance dispersal of seeds, a process that requires both a method of transport and an equivalence between the ecology of the source area and that of the recipient area.

There is some dispute about the method of transport involved. Some biologists argue that ocean and air currents are responsible for the transport of plant seeds to Hawaii. Yet the results of flotation experiments and the low temperatures of air currents cast doubt on these hypotheses. More probable is bird transport, either externally by accidental attachment of the seeds to feathers, or internally, by the

swallowing of fruit and subsequent excretion of the seeds. While it is likely that fewer varieties of plant seeds have reached Hawaii externally than internally more varieties are known to be adapted to external than to internal transport.

The author mentions
A
two methods of transport of seeds to Hawaii, namelg currents (ocean and air) and birds
B
that Hawaiian ecology does not match with any other ecology of the world
C
that the plant variety is due only to the ecology innate to Hawaii
D
None of the above
Question 24

Answer Questions 22 - 25 using the following reading passage:

Since the Hawaiian Islands have never been connected to other land masses, the great variety of plants in Hawaii must be a result of the long-distance dispersal of seeds, a process that requires both a method of transport and an equivalence between the ecology of the source area and that of the recipient area.

There is some dispute about the method of transport involved. Some biologists argue that ocean and air currents are responsible for the transport of plant seeds to Hawaii. Yet the results of flotation experiments and the low temperatures of air currents cast doubt on these hypotheses. More probable is bird transport, either externally by accidental attachment of the seeds to feathers, or internally, by the

swallowing of fruit and subsequent excretion of the seeds. While it is likely that fewer varieties of plant seeds have reached Hawaii externally than internally more varieties are known to be adapted to external than to internal transport.

The author asserts that
A
Hawaiian plant variety evolved independently from flora in other parts of the world
B
birds can not carry plant seeds long distances
C
bird transport happens more due to swallowing and subsequent excretion of seeds
D
bird transport is more likely due to accidental attachment of the seeds to feathers
Question 25

Answer Questions 22 - 25 using the following reading passage:

Since the Hawaiian Islands have never been connected to other land masses, the great variety of plants in Hawaii must be a result of the long-distance dispersal of seeds, a process that requires both a method of transport and an equivalence between the ecology of the source area and that of the recipient area.

There is some dispute about the method of transport involved. Some biologists argue that ocean and air currents are responsible for the transport of plant seeds to Hawaii. Yet the results of flotation experiments and the low temperatures of air currents cast doubt on these hypotheses. More probable is bird transport, either externally by accidental attachment of the seeds to feathers, or internally, by the

swallowing of fruit and subsequent excretion of the seeds. While it is likely that fewer varieties of plant seeds have reached Hawaii externally than internally more varieties are known to be adapted to external than to internal transport.

The author mentions the results of flotation experiments on plant seed,most probably in order to
A
support the claim that the distribution of plants in Hawaii is the result of the long-distance dispersal of seeds
B
lend credibility to the thesis that air currents provide a method of transport for plant seeds to Hawaii
C
suggest that the long-distance dispersal of seeds is a process that requires long periods of time
D
challenge the claim that ocean plant seeds to Hawaii currents are responsible for the transport of Plants seed t Hawaii
Question 26
Consider a schema R(A, B, C, D) and functional dependencies A→ B and C→ D. Then the decomposition of R into R1 (A, B) and R2(C, D) is
A
lossless join but not dependency preserving
B
dependency preserving but not lossless join
C
not dependency preserving and not lossless join
D
part dependency preserving and lossless join
       Database-Management-System       Functional-Dependency
Question 26 Explanation: 
The given decomposition is not lossless join because there is no common attributes between R1 and R2. But the given decomposition is dependency preserving, A→ B is covered by R1 and C→ D is covered by R2.
Question 27
Given relations R(w, x) and S(y,z), the result of select distinct w, x from R, S is guaranteed to be same as R, Provided
A
R and S have no duplicates
B
S has no duplicates and R is non-empty
C
R and S have the same number of tuples
D
R has no duplicates and S is non-empty
       Database-Management-System       SQL
Question 27 Explanation: 
A)Lets assume that S is empty(no duplicates) and R is not empty then RXS will be empty which will not be equal to R.Hence false.
B)Same reason as (A) .Hence false.
C)Lets assume R has duplicates,in this case,due to distinct keyword those duplicates will get eliminated in final result and the output will not be same as R.Hence false.
D)True.From above all options explaination we can conclude this as the answer.
Question 28
Suppose (A, B) and (C,D) are two relation schemas. Let r1 and r2 be the corresponding relation instances. B is a foreign key that refers to C in r2. If data in r1 and r2 satisfy referential integrity constraints, which of the following is ALWAYS TRUE?
A
πC(r2) - πB(r1) = Ф
B
πB(r1) -πC(r2) = Ф
C
πB(r1) - πC(r2) ≠ Ф
D
πB(r1) - πC(r2) = Ф
       Database-Management-System       Relational-Algebra
Question 28 Explanation: 
Since B is the foreign key that refers C in r2. So the B will contain the values that will be definitely present in C and C might contain more different values. So for sure
πB(r1) -πC(r2) = Ф
Question 29

Consider the following relations A, B, C. How many tuples does the result of the following relational algebra expression contain? Assume that the schema of A U B is the same as that of A.


A
7
B
4
C
5
D
9
       Database-Management-System       Relational-Algebra
Question 29 Explanation: 




Question 30

Consider the above tables A, B and C. How many tuples does the result of the following SQL query contains?

SELECT A.id

FROM A

WHERE A.age > ALL (SELECT B.age

FROM B

WHERE B.name - "Arun")
A
3
B
0
C
1
D
4
       Database-Management-System       SQL
Question 30 Explanation: 
All condition with empty return true
Also the result of subquery is empty So all id of A will be selected.
Question 31

Relation R is decomposed using a set of functional dependencies, F, and relation S Is decomposed using another set of functional dependencies, G. One decomposition is definitely BCNF, the other is definitely 3NF, but it is not known which is which.

To make a guaranteed identification, which one of the following tests should be used on the decompositions? (Assume that the closure of F and G are available).
A
Lossless-join
B
BCNF definition
C
3NF definition
D
Dependency-Preservation
       Database-Management-System       Normalization
Question 31 Explanation: 
Since one decomposition is in 3NF so it will not satisfy the BCNF conditions.Hence BCNF tests should be used on the decompositions.
Question 32
Consider a table T in a relational database with a key field K. A B-tree of order p is used as an access structure on K, where p denotes the maximum number of tree pointers in a B-tree index node. Assume that K is 10 bytes long; disk block size is 512 Bytes; each data pointer D is 8 bytes long and each block pointer PB is 5 bytes long. In order for each B-tree node to fit in a single disk block, the maximum value Of p is
A
22
B
23
C
32
D
20
       Database-Management-System       B-and-B+-Trees
Question 32 Explanation: 
< img src="https://solutionsadda.in/wp-content/uploads/2020/04/Screenshot_520.png">
Question 33
A B+- tree index is to be built on the Name attribute of the relation STUDENT. Assume that all student names are of length 8 bytes, disk blocks are of size 512 bytes, and index pointers are of size 4 bytes. Given this scenario, what would be the best choice of the degree (i.e. the number of pointers per node) of the B+- tree?
A
42
B
43
C
44
D
16
       Database-Management-System       B-and-B+-Trees
Question 33 Explanation: 
For B+ Tree (By default internal node)
Let the degree be p.
Let the index pointer be b.
Let the key value be k.
Question 34
Consider a hash table of size seven, with starting index zero, and a hash function (3x + 4) mod 7 . Assuming the hash table is initially empty which of the following is the contents of the table when the sequence 1, 3, 8, 10 is inserted into the table using closed hashing? Note that _ denotes an empty location in the table
A
1, 8, 10, _,_,_, 3
B
1, _,_,_,_,_, 3
C
1, 10, 8, _,_,_, 3
D
1, _,_,_,_,_, 10
       Data-Structures       Hashing
Question 34 Explanation: 
The elements to be inserted are,
1, 3, 8, 10
⟶ Insert 1,
(3 × 1 + 4) mod 7 = 0




Question 35
Which of the following best describes source routing concept?
A
The source sends packets for next hop router for forwarding according to router's tables
B
The source relies on OSPF optimal approach for finding the route to the destination from the OSPF routers
C
A sequence of forwarding router's addresses is generated at source and enclosed in the IP packet header.
D
None of the above.
Question 36
CSMA/CA is used in IEEE 802.11 series of standards. Which of the following is most appropriate to describe its function?
A
Set up medium access control using a token.
B
Set up medium access control in which hosts may transmit on the same channel simultaneously.
C
Establish a sequence of RTS and CTS packets to sense the channel utilisation.
D
To reduce transmission errors in a network.
Question 37
To reduce transmission errors in a network.
A
A denial-of-service attack
B
The uncontrolled cycle of increased retransmissions due to dropped packets by routers
C
A problem caused due to hacking of web servers
D
The uncontrolled injection of packets into firewall
Question 38
Network Address Translation is mainly used for
A
Separation of host addresses from the outer network
B
Finding the next host for forwarding packets from a domain
C
To increase the speed of accessing the Internet
D
Accessing a mail server
       Computer-Networks       Network-address-translation
Question 38 Explanation: 
Network Address Translation allows a single device, such as a router, to act as an agent between the Internet (or "public network") and a local (or "private") network
Question 39
Three-way handshake is used for
A
Dropping a TCP connection
B
Reliable establishment of a connection in the Internet transport layer
C
Multiplexing between three hosts on the same LAN
D
Exchange of packets at data link layer
       Computer-Networks       TCP
Question 39 Explanation: 
A three-way handshake is primarily used to create a TCP socket connection to reliably transmit data between devices
Question 40
A DNS server is most useful for
A
Finding the address of a host given a text query
B
Send an HTTP error message
C
Send an ICMP error message
D
Finding the address of the next forwarding router
       Computer-Networks       DNS
Question 40 Explanation: 
DNS stands for Domain Name System. The main function of DNS is to translate domain names into IP Addresses, which computers can understand. It also provides a list of mail servers which accept Emails for each domain name.
Question 41
TCP is often referred to as self-clocking because
A
TCP is often referred to as self-clocking because
B
TCP allows special encoding of clock signal in packet body
C
TCP uses acknowledgments to trigger increase in congestion window size
D
TCP allows for adjustment of time for retransmissions in packet networks
Question 42
To see that a sender's data may fit into the receiver's buffer, TCP adopts a method known as
A
Retransmission
B
Dropping of Packets
C
Congestion contro
D
Flow control
       Computer-Networks       TCP
Question 42 Explanation: 
Flow control is the process of managing the rate at which data is transmitted. Using flow control, a computer receiving data can signal that it is not ready to receive data. TCP provides a flow control mechanism using acknowledgements of TCP sequence numbers.
Question 43
It is known that SMTP protocol uses only ASCII data. Which of the following allows for sending any kind of data?
A
MIME
B
TIFF
C
MIPS
D
JPEG
       Computer-Networks       Application-Layer-Protocol
Question 43 Explanation: 
MIME is a kind of add on or a supplementary protocol which allows non-ASCII data to be sent through SMTP. It allows the users to exchange different kinds of data files on the Internet: audio, video, images, application programs as well.
Question 44
Software consists of
A
Set of instructions + Operating System
B
Programs + Documentation + Operating Procedures
C
Programs + Hardware Manuals
D
Set of programs
       Software-Engineering       Software-design
Question 44 Explanation: 
System software consists of the operating system and utility programs that control a computer system and allow you to use a computer.
Question 45
Project risk factor is considered in
A
Waterfall model
B
Waterfall model
C
Spiral model
D
Iterative enhancement model
       Software-Engineering       Software-process-models
Question 45 Explanation: 
Project risk factor is considered in Spiral model
Question 46
The outcome of construction phase may be treated as A. P
A
Product release
B
Beta release
C
Alpha release
D
All of the above
Question 47
FAST stands for
A
Functional Application Specification Technique
B
Facilitated Application Specification Technique
C
Fast Application Specification Technique
D
None of the above.
       Software-Engineering       Software-Engineering
Question 47 Explanation: 
FAST stands for Facilitated Application Specification Technique
Question 48
Which of the following is NOT a size measure for software?
A
LOC
B
Function count
C
Cyclomatic complexity
D
Holstead's program length
       Software-Engineering       Cyclomatic-metric
Question 48 Explanation: 
Cyclomatic complexity is not a size measure for software,it is the part of white box testing.
Question 49
The most desirable form of coupling is
A
Control coupling
B
Data coupling
C
Common coupling
D
Content coupling
       Software-Engineering       Coupling-and-Cohesion
Question 49 Explanation: 
Coupling between modules can be ranked in the order of strongest (least desirable) to weakest (most desirable) as follows: Content Coupling, Common Coupling, External Coupling, Control Coupling, Stamp Coupling, Data Coupling
Question 50
For a function of n variables, boundary value analysis yields
A
4n + 2 test cases
B
4n + 1 test cases
C
n+4 test cases
D
None of the above.
       Software-Engineering       Software-analysis
Question 50 Explanation: 
The basic idea of BVA is to use input variable values at their minimum, just above the minimum, a nominal value, just below their maximum and at their maximum. ... Thus, for a function of n variables, BVA yields (4n + 1) test cases.
Question 51
The process of transforming a model into source code is
A
Forward engineering
B
Re-engineering
C
Re-structuring
D
Reverse engineering
       Software-Engineering       Software-process-models
Question 51 Explanation: 
The process of transforming a model into source code is Forward engineering.
Question 52
Which of the following is NOT TRUE with respect to a simple graph?
A
Every fully connected graph is a tree
B
Every minimally connected graph is a tree
C
Every graph with n nodes and n-1 edges is a tree
D
Every connected graph with no cycles is a tree
       Engineering-Mathematics       Graph-Theory
Question 52 Explanation: 
A is false because fully connected graph or complete graph with more than 2 vertices is having cycles,But tree do not have cycles.
B is true.Tree is a connected graph with minimum no. of edges.
C is false because in this statement ‘connected’ word is not used ,so a graph with n vertices and n-1 edges can have cycles if the graph is disconnected.
D is true.
Question 53
The number of substrings that can be obtained from a string of length n is
A
⩰ n!
B
⩰ 2n
C
⩰ n2
D
⩰ nn
Question 53 Explanation: 
Assuming in the string of length n,all alphabets are distincts.
No. of distinct strings of length 1 = n
No. of distinct strings of length 2 = n-1
No. of distinct strings of length 3 = n-2
:
:
No. of distinct strings of length n = 1

Hence total no. of substrings = n+(n-1)+(n-2)+.........+1
=n(n+1)/1 ⩰ n^2
Question 54
When data to be sorted is larger than the main memory capacity ,which sorting algorithm would you prefer?
A
Heap sort
B
Insertion sort
C
Quick sort
D
Merge sort
       Algorithms       Sorting
Question 54 Explanation: 
External sorting is a term for a class of sorting algorithms that can handle massive amounts of data. External sorting is required when the data being sorted do not fit into the main memory of a computing device (usually RAM) and instead they must reside in the slower external memory (usually a hard drive). External sorting typically uses a hybrid sort-merge strategy. In the sorting phase, chunks of data small enough to fit in main memory are read, sorted, and written out to a temporary file. In the merge phase, the sorted sub-files are combined into a single larger file.
One example of external sorting is the external merge sort algorithm, which sorts chunks that each fit in RAM, then merges the sorted chunks together. We first divide the file into runs such that the size of a run is small enough to fit into main memory. Then sort each run in main memory using merge sort sorting algorithm. Finally merge the resulting runs together into successively bigger runs, until the file is sorted.
Question 55
VFAT, EXT2, EXT3 are examples of
A
File system types
B
Hard disk formatting commands
C
CPU architectures
D
Instruction set design formats
Question 55 Explanation: 
Some examples of filesystems are FAT, NTFS for Windows/DOS, HFS for MAC OS etc. In Linux, the popular filesystems are ext2, ext3 and ext4 filesystems. Some other filesystems such as ReiserFS are also natively supported by Linux.
Question 56
Which of the following is FALSE with respect to regular languages?
A
Regular languages form a subset of context free languages
B
Some regular languages can be infinite
C
Every finite language is regular
D
Context free languages form a subset of regular languages
       Theory-of-Computation       Regular-Language
Question 56 Explanation: 
All regular languages are context free languages but the reverse is not true. Hence option D in false.
Question 57
Putnam resource allocation model is based on
A
Putnam theory of software management
B
Function points
C
Norden/Rayleigh curve
D
Bochm's observations on man
       Software-Engineering       Software-process-models
Question 57 Explanation: 
Created by Lawrence Putnam, Sr. the Putnam model describes the time and effort required to finish a software project of specified size. SLIM (Software LIfecycle Management) is the name given by Putnam to the proprietary suite of tools his company QSM, Inc. has developed based on his model.
Question 58
Consider the five letters with percentage of occurrence in the text as a=35%, b= 20%, C=20%, d=15%, e=10%. If a binary tree is generated using Huffman code algorithm, with assigning 0 to every left edge and 1 to every right edge, then the code for letter e is:
A
10
B
110
C
111
D
011
E
None of the above
       Algorithms       Greedy-approach
Question 58 Explanation: 
Question 59
Which design paradigm is based on Principle of Optimality?
A
Divide and conquer
B
Greedy technique
C
Backtracking
D
Dynamic Programming
       Algorithms       Algorithm-Paradigms
Question 59 Explanation: 
Dynamic Programming is a paradigm of algorithm design in which an optimization problem is solved by a combination of achieving sub-problem solutions and appearing to the "principle of optimality".
Question 60
Given S1 : AAACCGTGAGTTATTCGTTCTAGAA and S2 - CACCCCTAAGGTACCTTTGGTTC, Longest Common Subsequence (LCS) is:
A
ACCTAGTACTTG
B
ACCTAGTACGTTG
C
ACCTAGTACTGTG
D
ACCTAGTACTTTG
Question 61
Consider the join of a relation R with relation ,S. If R has m tuples and S has n tuples, then the maximum size of join is:
A
mn
B
m+1
C
(m + n)/2
D
2(m + n)
       Database-Management-System       Relational-Algebra
Question 61 Explanation: 
For join the maximum size of join possible is m*n.
Question 62
If text T is of size n and pattern P of size m then the Knuth-Morris-Pratt Algorithm for pattern matching runs in time
A
O(m2 + n)
B
O(n log2 n)
C
O(m+n)
D
O(mn)
       Algorithms       Time-Complexity
Question 62 Explanation: 
Time complexity of Knuth-Morris-Pratt Algorithm is O(m+n).
Question 63
The Big-Oh estimate for an algorithm that takes 8n log n + 4n^(3/2) steps is
A
O(n log n)
B
O(n3/2)
C
O(n)
D
None of the above
       Algorithms       Asymptotic-Complexity
Question 63 Explanation: 
n^(3/2) is greater than nlogn. Hence the correct answer is B.
Question 64
Which command is used to remove an index from the database in SQL?
A
DROP INDEX
B
REMOVE INDEX
C
ROLL BACK INDEX
D
DELETE INDEX
       Database-Management-System       SQL
Question 64 Explanation: 
The DROP INDEX command is used to delete an index in a table.
Question 65
A relational scheme is in ...... if it is in 1NF and if aII non prime attributes are fully functionally dependent on the relation key
A
Second Normal Form
B
Boyce Codd Normal Form
C
F-ourth Normal Form
D
First Normal Form
       Database-Management-System       Normalization
Question 65 Explanation: 
If a relation schema is in 1NF and if aII non prime attributes are fully functionally dependent on the relation key then the relation schema is in 2NF, because the condition for the relation to be in 2NF is that ,non prime attributes should not be partially functionally dependent on key.
Question 66
A binary tree has n leaf nodes. The number of nodes of degree 2 in this tree is?
A
n-1
B
n
C
2n
D
log2n
       Data-Structures       Binary-Trees
Question 66 Explanation: 
If the binary tree has n nodes then no. of nodes of degree 2 in this tree is n-1.Take some examples and check it.
Question 67
A database trigger is:
A
A statement that is executed by user when debugging an application program
B
A condition the system tests for the validity of the database user
C
A statement that is executed automatically by the system as a side effect of modification on the database
D
A statement that enables to start any DBMS
       Database-Management-System       Trigger
Question 67 Explanation: 
A database trigger is procedural code that is automatically executed in response to certain events on a particular table or view in a database. The trigger is mostly used for maintaining the integrity of the information on the database.
Question 68
The natural join is equal to :
A
Combination of Union and Cartesian product
B
Combination of selection and Cartesian product
C
Combination of projection and Cartesian product
D
Cartesian Product
       Database-Management-System       Relational-Algebra
Question 69

Consider the following multiplicative loop of some program. What is the running time of this loop in terms of big-oh notations:

m :=1;

for i:= 1 to n do begin

m:= m * 3;

for j:= 1 to m do

{ Something that is O(1) }

end;
A
O(n*m3)
B
O(n3)
C
O(3n)
D
O(3m)
       Algorithms       Time-Complexity
Question 69 Explanation: 
When i=1, j runs 3 times
When i=2, j runs 32 times
When i=3, j runs 33 times

When i=n, j runs 3n times

Question 70
A logical schema is
A
standard way of organizing information into accessible parts
B
depends on physical storage
C
describes how data is actually stored on the disk
D
the entire database
       Database-Management-System       Schemas
Question 70 Explanation: 
Physical schema will deal with the how the data are stored on disk Logical scheme ,deal with relation and how data are organized.
Question 71
Which one is a virtual table that draws its data from the result of an SQL SELECT statement.
A
Synonym
B
View
C
Transaction
D
Sequence
       Database-Management-System       SQL
Question 71 Explanation: 
Views in SQL are kind of virtual tables. A view also has rows and columns as they are in a real table in the database. We can create a view by selecting fields from one or more tables present in the database. A View can either have all the rows of a table or specific rows based on certain condition.
Question 72
A Btree of order m has maximum of ...... children
A
m+l
B
m-1
C
m/2
D
m
       Database-Management-System       B-and-B+-Trees
Question 72 Explanation: 
A B tree of order m has maximum of m children and m-1 keys.
Question 73
If Cache Size is 64KB, Block size is 32B and the cache is Two-Way Set Associative. For a 32-bit physical address, the division between Block Offset, Index and Tag are:
A
10 bits, 10 bits, 10 bits
B
17 bits, 32 bits, 16 bits
C
32 bits, 64 bits, 22 bits
D
5 bits, 10 bits , 17 bits
       Computer-Organization       Cache
Question 73 Explanation: 
The structure of 32 bit address will be like,

∴ Tag field bits = 32 - (10 + 5) = 17
Question 74
RAID is used for
A
Fault tolerance and Performance in multiple disks
B
Used for generating speed of data access
C
Resource sharing tool
D
Rotating disks for access
       Computer-Organization       RAID
Question 74 Explanation: 
RAID is Redundant Array of Independent Disk. In this the data is stored in multiple disk to deal with fault tolerance.
Question 75
When a process is created using fork(), what is shared between parent process and child process?
A
Stack
B
Code segments
C
I/O handles
D
Heap
       Operating-Systems       System-Calls
Question 75 Explanation: 
Only the shared memory segments are shared between the parent process and the newly forked child process.And the rest like heap,stack are duplicated.
There are 75 questions to complete.